aav expression vector  (Addgene inc)

Journal: Nature Communications

Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

doi: 10.1038/s41467-025-61219-w

Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

Techniques: Gene Expression, Injection, Labeling

Journal: Journal of Virology

Article Title: BTP2 restricts Tulane virus and human norovirus replication independent of store-operated calcium entry

doi: 10.1128/jvi.00444-25

Figure Lengend Snippet: Amino acid changes in TV VP1 and VP2 are associated with BTP2 resistance. ( A ) Percent inhibition of monolayer clearance in crystal violet-based assay with three serial plaque-isolated susceptible viruses (gray) and three serial isolated resistant viruses (blue) (MOI 3) treated with a dose range of BTP2. ( B ) TV yield assay with one serial plaque-isolated susceptible virus (clone 1) and one serially isolated resistant virus (clone 1) challenged with DMSO or 10 µM BTP2. ( C ) Time course assay measuring yield at 1, 6, 12, and 24 hpi with one serial plaque-isolated susceptible virus (clone 1, gray) and one serially isolated resistant virus (clone 1, blue). ( D ) Schematic of amino acid differences identified between BTP2-susceptible and resistant clones. ( E ) Representative images of mean fluorescence intensity of cells transduced with adeno-associated viral (AAV) vectors expressing VP2 or mScarlet alone. Images were taken at 48 hours post-transduction (hpt). Scale bar = 100 µM. ( F ) Quantitation of mean fluorescence intensity across four biological replicates. ( G ) Western blot demonstrating expression of FLAG-tagged susceptible or resistant VP2 following AAV transduction. Cell lysates were harvested at 48 hpt. ( H ) Quantitation of western blot band intensity plotted relative to GAPDH. Each point represents an independent biological replicate. ( I ) Plaque assay titration of MA104 cells transduced with AAVs expressing mScarlet or susceptible or resistant VP2, infected with BTP2-susceptible TV (susceptible clone 1) at an MOI of 1, and treated with DMSO control or BTP2. Infections were performed 48 hpt, and compound treatment was done 1 hpi. ( J ) Fold change in virus yield between DMSO and BTP2 treatment conditions from panel I. For all AAV experiments, data were collected across four biological replicates. Normality was assessed by the Shapiro-Wilk test. TV yield assay data are plotted as geometric mean ± SD, * P < 0.05 by unpaired T test. Mean fluorescence intensity data is compared using Kruskal-Wallis with Dunn’s multiple comparisons test. For the fold change and western blot quantitation, * P < 0.05 by one-way ANOVA with Sidak’s multiple comparisons test.

Article Snippet: AAV vectors expressing mCherry and 3X FLAG-tagged TV VP2 or mScarlet alone were commercially synthesized and packaged (VectorBuilder).

Techniques: Inhibition, Crystal Violet Assay, Isolation, Virus, Clone Assay, Fluorescence, Transduction, Expressing, Quantitation Assay, Western Blot, Plaque Assay, Titration, Infection, Control

Journal: bioRxiv

Article Title: Region- and stage-specific cortical plasticity shapes the multifaceted process of habit formation

doi: 10.1101/2025.05.19.654900

Figure Lengend Snippet: (A) Mice received injection with AAV-CaMKII-hM4Di-mCherry in the ACC. On the next two days after the 6 th VR training, decision-making strategy was assessed by the devaluation test (first test). Before the free-access sessions, clozapine-N-oxide (CNO; 0.5 mg/kg) or its vehicle (VEH) was injected. After the first devaluation test, mice were re-trained with the VR schedule for one day. Then the second devaluation test was conducted with VEH or CNO injection in a cross-over design. (B) A representative image of hM4Di-mCherry expression in the ACC. (C) Effects of ACC inhibition on lever pressing in the devaluation test. (D) Within-subject changes in the devaluation index of (C) . (E) Mice received injection with AAV-CaMKII-hM3Dq-mCherry in the ACC. The first devaluation test was performed on the following the 4 th VI training. After the first test, mice were re-trained with the VI schedule for one additional day, after which the second devaluation test was performed. Same as (A) , drug injections were conducted in a cross-over design. (F) Representative image of hM3Dq-mCherry expression in the ACC. (G) Effects of the ACC activation on lever pressing in the devaluation tests. (H) Within-subject changes in the devaluation index of (G) . (I) Mice received injection with AAV-CaMKII-hM4Di-mCherry in the LOFC. The experimental protocol was same as (A) , except for the AAV injection sites. (J) Representative image of hM4Di-mCherry expression in the LOFC. (K) Effects of the LOFC inhibition on lever pressing in the devaluation tests. (L) Within-subject changes in the devaluation index of (K) . *P < 0.05; **P < 0.01.

Article Snippet: For DREADD experiments, the AAV vector expressing hM4Di (AAV-CaMKIIα-hM4Di-mCherry; Addgene #50477) or hM3Dq (AAV-CaMKIIα-hM3Dq-mCherry; Addgene #50476) was bilaterally injected into the ACC or lateral OFC.

Techniques: Injection, Expressing, Inhibition, Activation Assay

Journal: bioRxiv

Article Title: Region- and stage-specific cortical plasticity shapes the multifaceted process of habit formation

doi: 10.1101/2025.05.19.654900

Figure Lengend Snippet: Representative images of retrograde labeling with retroAAV-CAG-tdTomato. The retro AAV was injected in the central striatum (CS), retrosplenial cortex (RSC) and basolateral amygdala (BLA). For all three groups, tdTomato-positive neurons were detected in the ACC. (B–D) Acute brain slices of ACC were prepared within 30 min after the 3 rd CRF and 6 th VR training. Control (Ctrl) mice received food restriction but were not trained. AMPA/NMDA ratios were recorded from CS-projecting ACC layer 5 neurons (B) , RSC-projecting ACC layer 5 neurons (C) and BLA-projecting ACC layer 5 neurons (D) . (E–G) Acute brain slices of the ACC were prepared within 30 min after the 4 th VI training. The VR+VR group was introduced as a control matched for total training days. AMPA/NMDA ratios were recorded from CS-projecting ACC layer 5 neurons (E) , RSC-projecting ACC layer 5 neurons (F) and BLA-projecting ACC layer 5 neurons (G) . Black and blue dashed lines show the mean value of Ctrl and VR groups in (B–D) respectively. (H–J) Correlation between execution index and AMPA/NMDA ratios in the VR+VIHigh and VR+VILow groups. (K) Schematic diagram of VR training with CALI. Mice received CALI (illumination with 1–2 mW amber light for 1 min) within 5-min after each VR training session ended (days 4–9). (L) Representative image of CFL-SN expression and optic fiber implantation in the ACC. retroAAV-CaMKII-CFL-SN or retroAAV-CaMKII-SN were injected into the RSC and optic fibers implanted into the ACC. (M) Lever press rate during training with CALI. (N) Effects of CALI in RSC-projecting ACC neurons on lever pressing in the devaluation tests. (O) Within-subject changes in the devaluation index of (N) . *P < 0.05; **P < 0.01; ***P < 0.001; N.S., not significant.

Article Snippet: For DREADD experiments, the AAV vector expressing hM4Di (AAV-CaMKIIα-hM4Di-mCherry; Addgene #50477) or hM3Dq (AAV-CaMKIIα-hM3Dq-mCherry; Addgene #50476) was bilaterally injected into the ACC or lateral OFC.

Techniques: Labeling, Injection, Control, Expressing

Journal: bioRxiv

Article Title: Region- and stage-specific cortical plasticity shapes the multifaceted process of habit formation

doi: 10.1101/2025.05.19.654900

Figure Lengend Snippet: (A) Representative images for retrograde labeling of LOFC neurons with retroAAV-CAG-tdTomato. The retro AAV was injected in the central striatum (CS), retrosplenial cortex (RSC) and basolateral amygdala (BLA). Each image was taken from the same mouse shown in . tdTomato-positive neurons were not detected in the LOFC, when the retroAAV vector was injected in the RSC. (B,C) Acute brain slices of LOFC were prepared within 30 min after the 3 rd CRF and 6 th VR training. Control (Ctrl) mice underwent food restriction but were not trained. AMPA/NMDA ratios were recorded from CS-projecting LOFC layer 5 neurons (B) and BLA-projecting LOFC layer 5 neurons (C) . (D,E) Acute brain slices of the LOFC were prepared within 30 min after the 4 th VI training. The VR+VR group was introduced as a control matched for total training days. AMPA/NMDA ratios were recorded from the CS-projecting LOFC layer 5 neurons (D) and BLA-projecting LOFC layer 5 neurons (E) . Black and blue dashed lines show the mean value of the Ctrl and VR groups in (B,C) respectively. (F,G) Correlation between the execution index and AMPA/NMDA ratios in the VR+VIHigh and VR+VILow groups. (H) Schematic diagram of the two-step training protocol with CALI. Mice received CALI (illumination with 1–2 mW amber light for 1 min) within 5-min after each VI training (day 10–13). (I) Representative image of CFL-SN expression and optic fiber implantation in the LOFC. The retroAAV-CaMKII-CFL-SN or retroAAV-CaMKII-SN was injected into the CS and optic fibers were implanted into the LOFC. (J) Execution index during VI training with CALI. (K) Execution index on day 13 and the fraction of VR+VIHigh and VR+VILow mice in each group. (L) Effects of CALI in the CS-projecting LOFC neurons on lever pressing in the devaluation test. (M) Within-subject changes in the devaluation index of (L) . *P < 0.05; **P < 0.01; N.S., not significant.

Article Snippet: For DREADD experiments, the AAV vector expressing hM4Di (AAV-CaMKIIα-hM4Di-mCherry; Addgene #50477) or hM3Dq (AAV-CaMKIIα-hM3Dq-mCherry; Addgene #50476) was bilaterally injected into the ACC or lateral OFC.

Techniques: Labeling, Injection, Plasmid Preparation, Control, Expressing